ENSDARG00000071009

Ensembl ID:
ENSDARG00000071009
Human Orthologue:
KIF20B
Human Description:
kinesin family member 20B [Source:HGNC Symbol;Acc:7212]
Mouse Orthologue:
Kif20b
Mouse Description:
kinesin family member 20B Gene [Source:MGI Symbol;Acc:MGI:2444576]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36402 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5901 Nonsense Mutation detected in F1 DNA During 2016
sa972 Nonsense Available for shipment Available now
sa28850 Nonsense Mutation detected in F1 DNA During 2016
sa32150 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Essential Splice Site 64 1683 2 33
Genomic Location (Zv9):
Chromosome 17 (position 23301778)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23451927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGATAAGACCATTTTCAGCAGTTGAGATTGAGAATGGAGAATCACAGG[T/C]TAAAGATATATTCATATTTATTTATTTTTGCAGTGTATTGCACAACTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 420 1683 11 33
Genomic Location (Zv9):
Chromosome 17 (position 23305849)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23455998
KASP Assay ID:
554-3912.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCTTTCAGACAGCATGTTCCGTTCAGAGAGAGTAAACTCACTCACTA[T/A]CTGCAGGRCTACTTCACAGGCCGGGGCTCAGCCTGTATGATTGTAAAYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 813 1683 19 33
Genomic Location (Zv9):
Chromosome 17 (position 23312895)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23463044
KASP Assay ID:
554-0877.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAYACCTTATAAAGTTTTCTCAATTCTTTGTAGRCCCCCCGGAGGACT[T/A]GAAAATGCCTRAAGATGAAGCAGATGATGGGCGGGAAGACTCCGCCCTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa28850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 937 1683 19 33
Genomic Location (Zv9):
Chromosome 17 (position 23313266)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23463415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTAAATCACTAATGGCTAAGCGAGATCTTGAACTGAGAGAAAAGAAC[A/T]AACACATCTTGACTCTTGAAAAGGAAATTGCGCTAATGAGACAGAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 1308 1683 25 33
Genomic Location (Zv9):
Chromosome 17 (position 23318455)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23468604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGGCTTTTAGCTTGCCAATGAGAAGCAGCAGGCAGAACGCAAGAAGTG[G/A]ATGGAGGAGAAGTTGATTCTGATTGGTCAGGCTAAAGAAGCTGAGGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link