ENSDARG00000071009

Ensembl ID:
ENSDARG00000071009
Human Orthologue:
KIF20B
Human Description:
kinesin family member 20B [Source:HGNC Symbol;Acc:7212]
Mouse Orthologue:
Kif20b
Mouse Description:
kinesin family member 20B Gene [Source:MGI Symbol;Acc:MGI:2444576]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5901 Nonsense Mutation detected in F1 DNA During 2014
sa972 Nonsense Available for shipment Available now
sa19174 Nonsense Mutation detected in F1 DNA During 2014
sa2945 Nonsense Mutation detected in F1 DNA During 2014
sa7830 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 420 1683 11 33
Genomic Location:
Chromosome 17 (position 23305849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCTTTCAGACAGCATGTTCCGTTCAGAGAGAGTAAACTCACTCACTA[T/A]CTGCAGGRCTACTTCACAGGCCGGGGCTCAGCCTGTATGATTGTAAAYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 813 1683 19 33
Genomic Location:
Chromosome 17 (position 23312895)
KASP Assay ID:
554-0877.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAYACCTTATAAAGTTTTCTCAATTCTTTGTAGRCCCCCCGGAGGACT[T/A]GAAAATGCCTRAAGATGAAGCAGATGATGGGCGGGAAGACTCCGCCCTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 1232 1683 23 33
ENSDART00000104718 Nonsense 1232 1683 23 33
Genomic Location:
Chromosome 17 (position 23317407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGAGCGTGAGCGTGTTATTGAAGACATGCGCTTGGCTCTGACAGAA[C/T]AGGAGGAAACACAGACACAGCTGGACCTTGAGTTGGACAACAGAGACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 1232 1683 23 33
ENSDART00000104718 Nonsense 1232 1683 23 33
Genomic Location:
Chromosome 17 (position 23317407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAGAGCGTGAGCGTGTTATTGAAGACATGCGCTYGGCTCTGACAGAA[C/T]ARGAGGAAACACAGACAMAGCTGGACCTTGAGTTGGACAACARAGACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104718 Nonsense 1255 1683 23 33
Genomic Location:
Chromosome 17 (position 23317476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGACCTTGAGTTGGACAACARARACGCTCGGATTGATGAGCTCACT[C/T]AAGGTACAGGATAAATGGAGAGTATTGCAATCATGTTTGGGCTTAAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hxmpkea0