pcgf5a

Ensembl ID:
ENSDARG00000071007
ZFIN ID:
ZDB-GENE-080723-33
Description:
Polycomb group RING finger protein 5-A [Source:UniProtKB/Swiss-Prot;Acc:B3DK16]
Human Orthologue:
PCGF5
Human Description:
polycomb group ring finger 5 [Source:HGNC Symbol;Acc:28264]
Mouse Orthologue:
Pcgf5
Mouse Description:
polycomb group ring finger 5 Gene [Source:MGI Symbol;Acc:MGI:1923505]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23073 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104715 Nonsense 117 234 6 9
Genomic Location (Zv9):
Chromosome 17 (position 23267530)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23417679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGATTTTCTTTGTCTTTCTTCTAGATGGTCCTAGAGCTAAGAAATCT[C/T]GACTGAGTGGTGAAGATGATGATGGGAATGGTGGAGACTACCACAGGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link