ppp1r3ca

Ensembl ID:
ENSDARG00000071005
ZFIN ID:
ZDB-GENE-040718-70
Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3Ca [Source:RefSeq peptide;Acc:NP_001002376]
Human Orthologue:
PPP1R3C
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3C [Source:HGNC Symbol;Acc:9293]
Mouse Orthologue:
Ppp1r3c
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene [Source:MGI Symbol;Acc:MGI:1858229]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8741 Nonsense Mutation detected in F1 DNA During 2017
sa23072 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128073 Nonsense 148 324 2 2
Genomic Location (Zv9):
Chromosome 17 (position 23142454)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23292603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTCAGTCCAGAGCAGGATTCTGGATTTTCTGCAACCAGCAGCAGACTA[C/A]CTGGAWTTCCGTAGTCATCTGCTGAAGAAMTTGGTTTGTTTGGAGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128073 Nonsense 303 324 2 2
Genomic Location (Zv9):
Chromosome 17 (position 23142917)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23293066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTAAGAAAACACAAGAGAAGGGCGTTTTTAAATGTAAAAGTTCACTA[C/T]AATCCAATGGCATTTTTCCAAATTGGCAGAGTTGGGGTCAGATTGCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link