si:ch211-107m8.2

Ensembl ID:
ENSDARG00000070995
ZFIN ID:
ZDB-GENE-081104-521
Description:
inositol polyphosphate-4-phosphatase, type I-like [Source:RefSeq peptide;Acc:NP_001122019]
Human Orthologue:
INPP4A
Human Description:
inositol polyphosphate-4-phosphatase, type I, 107kDa [Source:HGNC Symbol;Acc:6074]
Mouse Orthologue:
Inpp4a
Mouse Description:
inositol polyphosphate-4-phosphatase, type I Gene [Source:MGI Symbol;Acc:MGI:1931123]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38543 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8633 Nonsense Mutation detected in F1 DNA During 2017
sa10195 Nonsense Available for shipment Available now
sa33832 Nonsense Available for shipment Available now
sa20671 Nonsense Available for shipment Available now
sa18836 Nonsense Mutation detected in F1 DNA During 2017
sa10910 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Essential Splice Site 275 940 9 22
ENSDART00000100762 Essential Splice Site 266 917 9 21
Genomic Location (Zv9):
Chromosome 6 (position 14138266)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14098228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTCTGATGAGAGTGTCTTGACATAATTTTGTGTTGTGATGCTGGTA[G/A]GGTATCTGAGCTGGAGGAGTTGGGAGAATTATCCCCATGTTGGGAGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 527 940 13 22
ENSDART00000100762 Nonsense 516 917 13 21
Genomic Location (Zv9):
Chromosome 6 (position 14120225)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14080187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGGCAGCAACAGCCGTTCATCCCTCCATGTTGATTGGCATGAGGAAGAGT[G/A]GGTAAGAAAAYWTCTCTTAKATTTTTATTTTAATTACAATATTTTAWTAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 668 940 17 22
ENSDART00000100762 Nonsense 645 917 16 21
Genomic Location (Zv9):
Chromosome 6 (position 14104945)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14064907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCATTATCAAGCTGAGAAACTGTCTCCGTGATGATGGTTTTCTAAGA[C/T]AGCTTTAYACCATYGGCCTGYTCGCTCAGTTTGAGTGTCTRTTGAGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 854 940 21 22
ENSDART00000100762 Nonsense 831 917 20 21
Genomic Location (Zv9):
Chromosome 6 (position 14098904)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14058866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATATTTGTGCCTCTACATGCTCAGATTTGCCGACGACTGAACGGAGTG[C/T]GATTCACCAGCTGCAAAAGTGCCAAGGACCGCACTGCCATGTCAGTAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 911 940 22 22
ENSDART00000100762 Nonsense 888 917 21 21
Genomic Location (Zv9):
Chromosome 6 (position 14084260)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14044222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCCAGCGAGGGCTGCCGTCGCGAGAATACCACGAAGAACGTTGGATG[T/A]CGCAAGTATGCCTTTAACTGTCTGCAGCTGAAGGCTTTTCCTAAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 920 940 22 22
ENSDART00000100762 Nonsense 897 917 21 21
ENSDART00000061745 Nonsense 920 940 22 22
ENSDART00000100762 Nonsense 897 917 21 21
Genomic Location (Zv9):
Chromosome 6 (position 14084235)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14044197
KASP Assay ID:
2259-7328.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATACCACGAAGAACGTTGGATGTCGCAAGTATGCCTTTAACTGTCTG[C/T]AGCTGAAGGCTTTTCCTAAACATTACAGACCTCCTGATGGCACTTTCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061745 Nonsense 920 940 22 22
ENSDART00000100762 Nonsense 897 917 21 21
ENSDART00000061745 Nonsense 920 940 22 22
ENSDART00000100762 Nonsense 897 917 21 21
Genomic Location (Zv9):
Chromosome 6 (position 14084235)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14044197
KASP Assay ID:
2259-7328.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATACCACGAAGAACGTTGGATGTCGCAARTATGCCTTTAAYTGTCTG[C/T]AGCTGAAGGYTTTTCCTAAACATTACAGACCTCCYGAYGGCACTTTYGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link