mlpha

Ensembl ID:
ENSDARG00000070991
ZFIN ID:
ZDB-GENE-050208-724
Description:
melanophilin b [Source:RefSeq peptide;Acc:NP_001073147]
Human Orthologue:
MLPH
Human Description:
melanophilin [Source:HGNC Symbol;Acc:29643]
Mouse Orthologue:
Mlph
Mouse Description:
melanophilin Gene [Source:MGI Symbol;Acc:MGI:2176380]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20675 Nonsense Mutation detected in F1 DNA During 2014
sa16116 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104671 Nonsense 209 503 6 12
ENSDART00000128940 Nonsense 209 518 6 13
ENSDART00000135583 Nonsense 209 503 7 13
Genomic Location:
Chromosome 6 (position 15524851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCCACCCCATGGATTTGGAAATAGACGACTATGCCGTTCACTCTCGC[A/T]GACAGTCTGTCCAGGTATGAGAAGGTTCATTTTTATTGTCAGTAGTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104671 Nonsense 227 503 7 12
ENSDART00000128940 Nonsense 227 518 7 13
ENSDART00000135583 Nonsense 227 503 8 13
Genomic Location:
Chromosome 6 (position 15524713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCAGYACATCCATGATGATAGAGGTCAGCGGAATGATCTAGAATA[C/A]AACTCTGAAATCTACCATCAGCATCAGCAACGCATGAACCGCAGGAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/csap2b4i