sergef

Ensembl ID:
ENSDARG00000070986
ZFIN ID:
ZDB-GENE-061220-11
Description:
Sergef protein [Source:UniProtKB/TrEMBL;Acc:Q08BJ6]
Human Orthologue:
SERGEF
Human Description:
secretion regulating guanine nucleotide exchange factor [Source:HGNC Symbol;Acc:17499]
Mouse Orthologue:
Sergef
Mouse Description:
secretion regulating guanine nucleotide exchange factor Gene [Source:MGI Symbol;Acc:MGI:1351630]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38010 Nonsense Mutation detected in F1 DNA During 2017
sa6797 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104659 Nonsense 117 423 3 12
Genomic Location (Zv9):
Chromosome 25 (position 8399061)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8011585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAGCTAGGGCTCGGTCACACCTTAGAGATTATGACCTTTCAGACCTG[C/A]CCTTTACCTGGGTTTGGAAGAGTTCAGCAGGTGTCCTGTGGGTGGGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104659 Nonsense 369 423 11 12
Genomic Location (Zv9):
Chromosome 25 (position 8373606)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7986130
KASP Assay ID:
554-4642.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTACATCTGTCTCTGTCTGTCTCTCTTCAGGGGGTCGGGTCTTCTCCT[G/A]GGGCTGGAATGAACATGGAATGTGTGGCGACGGTTCCCTTCAGGACATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link