ash1l

Ensembl ID:
ENSDARG00000070981
ZFIN ID:
ZDB-GENE-030131-6101
Description:
Novel protein similar to vertebrate ash1 (Absent, small, or homeotic)-like (Drosophila) (ASH1L) [Sou
Human Orthologue:
ASH1L
Human Description:
ash1 (absent, small, or homeotic)-like (Drosophila) [Source:HGNC Symbol;Acc:19088]
Mouse Orthologue:
Ash1l
Mouse Description:
ash1 (absent, small, or homeotic)-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2183158]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4786 Nonsense Mutation detected in F1 DNA During 2014
sa18097 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Nonsense 967 2962 2 25
ENSDART00000127755 Nonsense 943 2938 2 25
Genomic Location:
Chromosome 19 (position 9669151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACCACTCATTCTCATTTCCACCGCCTACTTTTTCAGCCCCCTCTGCT[C/T]GATCTGTAGCAAGTGCTGCAACATCCACTGCACACCCATCTCAGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Nonsense 1526 2962 2 25
ENSDART00000127755 Nonsense 1502 2938 2 25
Genomic Location:
Chromosome 19 (position 9670828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAACGGTACAAGCGAAAAGAGGCCTCTATGTCTTGTCTTGGGCCCTCA[C/T]GACTGTCTWTGGGCACTGCAAGTCGGGGACATCATCCTGTTGACTCCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k551psqr