ash1l

Ensembl ID:
ENSDARG00000070981
ZFIN ID:
ZDB-GENE-030131-6101
Description:
Novel protein similar to vertebrate ash1 (Absent, small, or homeotic)-like (Drosophila) (ASH1L) [Sou
Human Orthologue:
ASH1L
Human Description:
ash1 (absent, small, or homeotic)-like (Drosophila) [Source:HGNC Symbol;Acc:19088]
Mouse Orthologue:
Ash1l
Mouse Description:
ash1 (absent, small, or homeotic)-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2183158]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18097 Nonsense Available for shipment Available now
sa43225 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43226 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Nonsense 1526 2962 2 25
ENSDART00000127755 Nonsense 1502 2938 2 25
Genomic Location (Zv9):
Chromosome 19 (position 9670828)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9129367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAACGGTACAAGCGAAAAGAGGCCTCTATGTCTTGTCTTGGGCCCTCA[C/T]GACTGTCTWTGGGCACTGCAAGTCGGGGACATCATCCTGTTGACTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Essential Splice Site 1985 2962 5 25
ENSDART00000127755 Essential Splice Site 1961 2938 5 25
Genomic Location (Zv9):
Chromosome 19 (position 9673901)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9132440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCAGGTGAACATGACTATGGCCTTCTTCCTGCTCCCATTCATGTTGG[T/C]GAGTTTCTACAAATTTTAACCTGCCTAAATTTAGCCCAATATCTGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052915 Essential Splice Site 2179 2962 10 25
ENSDART00000127755 Essential Splice Site 2155 2938 10 25
Genomic Location (Zv9):
Chromosome 19 (position 9681111)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9139650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTTTGTCAACCACAGCTGCGAGCCCAACTGTGAGATGCAGAAATGG[T/A]GAGTAAAAATGAGACCATGGATGAGTCACTCAATAAAATCCCATCAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link