LOC562973

Ensembl ID:
ENSDARG00000070973
Human Orthologue:
GCGR
Human Description:
glucagon receptor [Source:HGNC Symbol;Acc:4192]
Mouse Orthologue:
Gcgr
Mouse Description:
glucagon receptor Gene [Source:MGI Symbol;Acc:MGI:99572]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40161 Nonsense Mutation detected in F1 DNA During 2016
sa8147 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104639 Nonsense 102 520 4 13
Genomic Location:
Chromosome 3 (position 51073973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTCCGGCATGGGCTTGTGCATGTGGAGTGTGATGCAGACGGACAGTA[C/A]AGCAAGCAGAAGGATGCCAGTGAATGTCTGTCACGTGACAACATAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104639 Essential Splice Site 117 520 4 13
Genomic Location:
Chromosome 3 (position 51073926)
KASP Assay ID:
2259-4099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAGCAAGCAGAAGGATGCCAGTGAATGTCTGTCRCGTGACAACATAG[T/C]AAGTCAGAAACACTGGCACTGTTTAAATGCTGGATGAATTAGCGTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104639 Nonsense 333 520 10 13
Genomic Location:
Chromosome 3 (position 51047847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATCCTCGTKTCCAAACTGAGGGCGCATCAGATGAGATATTCTGACTA[C/A]AAGTTCCGGTAGGTGTCCTGCASTTAGTTTRCCCAAAAATRAAAATGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link