LOC562973

Ensembl ID:
ENSDARG00000070973
Human Orthologue:
GCGR
Human Description:
glucagon receptor [Source:HGNC Symbol;Acc:4192]
Mouse Orthologue:
Gcgr
Mouse Description:
glucagon receptor Gene [Source:MGI Symbol;Acc:MGI:99572]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8147 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104639 Essential Splice Site 117 520 4 13
Genomic Location:
Chromosome 3 (position 51073926)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAGCAAGCAGAAGGATGCCAGTGAATGTCTGTCRCGTGACAACATAG[T/C]AAGTCAGAAACACTGGCACTGTTTAAATGCTGGATGAATTAGCGTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104639 Nonsense 333 520 10 13
Genomic Location:
Chromosome 3 (position 51047847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATCCTCGTKTCCAAACTGAGGGCGCATCAGATGAGATATTCTGACTA[C/A]AAGTTCCGGTAGGTGTCCTGCASTTAGTTTRCCCAAAAATRAAAATGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lfys6177