lepr

Ensembl ID:
ENSDARG00000070961
ZFIN IDs:
ZDB-GENE-080104-1, ZDB-GENE-080104-1
Description:
leptin receptor [Source:RefSeq peptide;Acc:NP_001106847]
Human Orthologue:
LEPR
Human Description:
leptin receptor [Source:HGNC Symbol;Acc:6554]
Mouse Orthologue:
Lepr
Mouse Description:
leptin receptor Gene [Source:MGI Symbol;Acc:MGI:104993]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12953 Nonsense Available for shipment Available now
sa323 Nonsense F2 line generated During 2016
sa38556 Nonsense Mutation detected in F1 DNA During 2016
sa5372 Nonsense F2 line generated During 2016
sa1508 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079173 Nonsense 81 988 5 20
ENSDART00000104616 Nonsense 91 1088 3 19
Genomic Location (Zv9):
Chromosome 6 (position 30911269)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31232185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGAAAGTAACTAACAAGAGAATGCAATCTCTTTTCAGGAAGCTGTT[T/A]GGACAYCCTGTGCTGGCTTGAAGGTGAAYGGGAAAATTTGATTTGTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa323
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079173 Nonsense 374 988 10 20
ENSDART00000104616 Nonsense 383 1088 9 19
Genomic Location (Zv9):
Chromosome 6 (position 30893021)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31213937
KASP Assay ID:
554-3312.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTCAAATCTGCTCTTTTCCAGGAAGGTTTAACGCAAATATTACCTGC[G/T]AAAGCGAGTATTCATATGTGGACACCATGATCTGTAAGTGGAATCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079173 Nonsense 441 988 11 20
ENSDART00000104616 Nonsense 441 1088 10 19
Genomic Location (Zv9):
Chromosome 6 (position 30892080)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31212996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGATCACAGACAGTGCACCTTAAGCCAAATCAGCATGATCTTTTGCTA[T/A]AAATTCTGGCTTGAAGTGGAAGGAGGACGTGGCCAATCGTTTCCTGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5372
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079173 Nonsense 554 988 13 20
ENSDART00000104616 Nonsense 554 1088 12 19
Genomic Location (Zv9):
Chromosome 6 (position 30890495)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31211411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTASAAGTTCGCTGTAAAGACGTGAACGACACTGGATACTGGAGCGACT[G/A]GAGCAATAGTCACATTTCCACTGTTTTCAACTTRAAAGGTAAATTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079173 Nonsense 807 988 19 20
ENSDART00000104616 Nonsense 830 1088 18 19
Genomic Location (Zv9):
Chromosome 6 (position 30881667)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 31202583
KASP Assay ID:
554-1432.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGGATGAAAAAACTCATGTGGAAGGATGTTCCAAATCCCAACAAGTG[C/A]TCTTGGGCCAAAGGAATGGACTTCAGGCAGGTTAGTGTGACCTACTGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Genetic Loci associated with C-reactive protein levels and risk of coronary heart disease. (View Study)
  • C-reactive protein: Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women. (View Study)
  • C-reactive protein: Loci related to metabolic-syndrome pathways including LEPR,HNF1A, IL6R, and GCKR associate with plasma C-reactive protein: the Women's Genome Health Study. (View Study)
  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • Metabolic traits: Genome-wide association analysis of metabolic traits in a birth cohort from a founder population. (View Study)
  • Soluble leptin receptor levels: Genome-wide association study identifies polymorphisms in LEPR as determinants of plasma soluble leptin receptor levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link