si:ch211-288g17.4

Ensembl ID:
ENSDARG00000070960
ZFIN ID:
ZDB-GENE-060531-62
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPI8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43229 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104622 Essential Splice Site 290 529 11 17
ENSDART00000133447 Essential Splice Site 290 520 11 17
Genomic Location (Zv9):
Chromosome 19 (position 9980507)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9439046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGATGACTGCCTTGTCATACCTGTGACTGAACTCTTCTTCTTTATCTA[G/A]TTGGGCAGATCAGCAGGGTTTTAGTCTTGTTTATGACAAAACTGCCCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link