si:ch211-288g17.3

Ensembl ID:
ENSDARG00000070959
ZFIN ID:
ZDB-GENE-030131-461
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPI6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43230 Nonsense Mutation detected in F1 DNA During 2017
sa39232 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104620 Nonsense 163 378 1 1
ENSDART00000139385 Nonsense 163 378 2 2
Genomic Location (Zv9):
Chromosome 19 (position 10080938)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9539477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTCGCTAACGGACCTCCGCGAAAAAGAGGCAGACCATCCGGTGCCT[T/A]GAAGAAAAAGAGGGGTCGGCCTGCAGGTTCCACTAAGATTGCCAGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104620 Nonsense 202 378 1 1
ENSDART00000139385 Nonsense 202 378 2 2
Genomic Location (Zv9):
Chromosome 19 (position 10081054)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9539593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAGAGGTCGCCCTCCAGGTTCTCTAAACAAAGTGAAGAAGCTTCAG[C/T]AAACTGATGGATCGCCCCGAAAAAGAGGCCGTCCCCCAGGCACAGGGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link