si:ch73-197b13.2

Ensembl ID:
ENSDARG00000070958
ZFIN ID:
ZDB-GENE-081104-252
Description:
Novel protein similar to H.sapiens PEX6, peroxisomal biogenesis factor 6 (PEX6) [Source:UniProtKB/Tr
Human Orthologue:
PEX6
Human Description:
peroxisomal biogenesis factor 6 [Source:HGNC Symbol;Acc:8859]
Mouse Orthologue:
Pex6
Mouse Description:
peroxisomal biogenesis factor 6 Gene [Source:MGI Symbol;Acc:MGI:2385054]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43884 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104613 Nonsense 929 1071 16 19
ENSDART00000145029 Nonsense 223 365 7 10
Genomic Location (Zv9):
Chromosome 22 (position 40967612)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38055913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGCAGGGTTGTCTCGCAGCTTTTGGCAGAGCTGGATGGTCTTCATT[C/A]GTCTGGAGACGTCTTCGTGATTGGAGCAACTAATCGTCCAGATCTGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link