ENSDARG00000070957

Ensembl ID:
ENSDARG00000070957
Human Orthologue:
MFSD1
Human Description:
major facilitator superfamily domain containing 1 [Source:HGNC Symbol;Acc:25874]
Mouse Orthologue:
Mfsd1
Mouse Description:
major facilitator superfamily domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15500 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061540 Essential Splice Site 149 372 5 10
Genomic Location:
Chromosome 24 (position 40776798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGACCGGACGACTTCTGTTTGGCTCTGGAAAYGGATCTTTGACCAG[T/A]ATGACAACCGATATTCACTTACAACACATNNNNNNNGTTAAAACACAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f4p6bufk