tecra

Ensembl ID:
ENSDARG00000070956
ZFIN ID:
ZDB-GENE-090930-1
Human Orthologue:
TECR
Human Description:
trans-2,3-enoyl-CoA reductase [Source:HGNC Symbol;Acc:4551]
Mouse Orthologue:
Tecr
Mouse Description:
trans-2,3-enoyl-CoA reductase Gene [Source:MGI Symbol;Acc:MGI:1915408]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20137 Nonsense Available for shipment Available now
sa33305 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40159 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20138 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104614 Nonsense 10 346 1 11
Genomic Location (Zv9):
Chromosome 3 (position 50557715)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 45252135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGATACATTTGAGGAGCTATCATGGATGCTTTAGCTTTAGAAGCGAAA[G/T]GAGCCAAGGGTGAAGGTTCGGCGGCTCCTGCTCCTGCTGCTCCACCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104614 Essential Splice Site 61 346 2 11
Genomic Location (Zv9):
Chromosome 3 (position 50558609)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 45253029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTATGCTAGCATGTCTTAGCTATTTAGCATCTTAACATTTTTCTAC[A/T]GGTAGAGCCAACAGCCACGATTCTGGACATTAAGTCTATGTTCCACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104614 Essential Splice Site 128 346 5 11
Genomic Location (Zv9):
Chromosome 3 (position 50572068)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 45266488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTGAGCTCTTTCATATGTTGACTTCATCAGCCTGAATGTGTGTTTGC[A/T]GGTGTTCTTAATCGAGTGCATTGGACCACTTGTCCTGTACCTGCTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104614 Nonsense 176 346 6 11
Genomic Location (Zv9):
Chromosome 3 (position 50572452)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 45266872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTGTCTGTTCTCCACAGTATAGCCTGTGCCTGTCACACCTTCCACTA[T/A]GCAAAGAGGATCATGGAGACATTGTTTGTCCATCGCTTCTCCCATGGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link