hmx3

Ensembl ID:
ENSDARG00000070955
ZFIN ID:
ZDB-GENE-001020-1
Description:
Homeobox protein HMX3 [Source:UniProtKB/Swiss-Prot;Acc:Q504H8]
Human Orthologue:
HMX3
Human Description:
H6 family homeobox 3 [Source:HGNC Symbol;Acc:5019]
Mouse Orthologue:
Hmx3
Mouse Description:
H6 homeobox 3 Gene [Source:MGI Symbol;Acc:MGI:107160]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23054 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104612 Nonsense 119 297 2 2
Genomic Location (Zv9):
Chromosome 17 (position 21622057)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21772206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTTCGCCGACCACAGGCACCGACCGAGATTCCCCCGAGCTTGTGCTC[A/T]AATCAGATCCGGACGCCAAGGACGATGAAGACGACAACAAAAGTGGCGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link