si:dkey-14o18.6

Ensembl ID:
ENSDARG00000070950
ZFIN ID:
ZDB-GENE-060503-428
Description:
Novel protein similar to vertebrate serine/threonine/tyrosine kinase 1 (STYK1) [Source:UniProtKB/TrE
Human Orthologue:
STYK1
Human Description:
serine/threonine/tyrosine kinase 1 [Source:HGNC Symbol;Acc:18889]
Mouse Orthologue:
Styk1
Mouse Description:
serine/threonine/tyrosine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2141396]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39233 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6546 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104596 Essential Splice Site 18 435 2 9
ENSDART00000132124   None 255 None 6
Genomic Location (Zv9):
Chromosome 19 (position 10294680)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9753219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTAGATCTGTTTATTATTATTGAAATTGTGTTTCTATTTCTCCTTGC[A/T]GAGGTGCTTTTTTATCAAGTCGAACTGATCGTCGTTCCAGTTCTGTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104596 Essential Splice Site 339 435 7 9
ENSDART00000132124 Essential Splice Site 169 255 4 6
Genomic Location (Zv9):
Chromosome 19 (position 10299476)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9758015
KASP Assay ID:
554-4581.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATAGATGGTCCTTTGGYATTTTGCTCTATGAGATGGTGACATTAGG[T/C]GAGTGTGTCCGTTGACAAGTTTTGTGGTTTTCAGTTACAGAGAGCATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104596 Nonsense 410 435 9 9
ENSDART00000132124 Nonsense 240 255 6 6
Genomic Location (Zv9):
Chromosome 19 (position 10303640)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9762179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGAAAGCTCCAATCAGGAGAGRGAAGYGCAAATGATCAGGCAGTGCTG[C/T]GAGTGTCGGAGCCGCTGGACATAGAGAAATACATGCAAGAGGCGGGATWT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link