si:ch211-232m10.6

Ensembl ID:
ENSDARG00000070931
ZFIN ID:
ZDB-GENE-060503-879
Description:
hypothetical protein LOC572203 [Source:RefSeq peptide;Acc:NP_001092222]
Human Orthologue:
AC027045.1
Human Description:
Putative germ cell-specific gene 1-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A8MUP6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39234 Nonsense Mutation detected in F1 DNA During 2017
sa43238 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104548 Nonsense 64 205 2 3
ENSDART00000126547 Nonsense 203 242 5 6
ENSDART00000131517 Nonsense 228 369 7 8
Genomic Location (Zv9):
Chromosome 19 (position 10979842)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10438381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGTATTCCAGATGACTGTCAGCATTGGGCCCAAAGACTGGAGACCT[C/T]AGACCTGGGACTACGGCTGGTCATTTGCGTGAGTATCCTTATACCTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104548 Nonsense 93 205 3 3
ENSDART00000126547 Nonsense 232 242 6 6
ENSDART00000131517 Nonsense 257 369 8 8
Genomic Location (Zv9):
Chromosome 19 (position 10979357)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10437896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCTTCAGCTGTTGCATGGCGGCGGCCGTATTCACACTAAACTCTTA[C/A]ACCAAAACATTGATTGAGATGAAACACCGTGCCCGTGTCCGTCTGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link