cpne5

Ensembl ID:
ENSDARG00000070919
ZFIN ID:
ZDB-GENE-040426-1398
Description:
copine V [Source:RefSeq peptide;Acc:NP_957322]
Human Orthologue:
CPNE5
Human Description:
copine V [Source:HGNC Symbol;Acc:2318]
Mouse Orthologue:
Cpne5
Mouse Description:
copine V Gene [Source:MGI Symbol;Acc:MGI:2385908]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41760 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41761 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050098 Essential Splice Site 247 429 10 14
ENSDART00000104503 Essential Splice Site 392 574 17 21
ENSDART00000126071 Essential Splice Site 375 557 16 21
Genomic Location (Zv9):
Chromosome 11 (position 3152935)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3104423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTGGTTTAAATGAAGATGCAAATATGATCCACTGATCTCTGTCTTTC[A/T]GAATGGAAATATTGAGAATCCCTACTGTAATGGTATCGAGGGGATACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050098 Nonsense 295 429 11 14
ENSDART00000104503 Nonsense 440 574 18 21
ENSDART00000126071 Nonsense 423 557 17 21
Genomic Location (Zv9):
Chromosome 11 (position 3155621)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3107109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTGATTTTTAATTTTTTTCTGTTCTGTGAAGGTACGCAGCTGCTGTA[C/T]AGGACGGCTCGCAGTATTTCATTCTCCTCATCATCACAGACGGGGTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link