si:ch211-284e20.8

Ensembl ID:
ENSDARG00000070918
ZFIN ID:
ZDB-GENE-050208-451
Description:
fetuin-B [Source:RefSeq peptide;Acc:NP_001038489]
Human Orthologue:
FETUB
Human Description:
fetuin B [Source:HGNC Symbol;Acc:3658]
Mouse Orthologue:
Fetub
Mouse Description:
fetuin beta Gene [Source:MGI Symbol;Acc:MGI:1890221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3187 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa3187
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104504 Essential Splice Site 188 306 5 8
ENSDART00000124162 Essential Splice Site 188 306 5 7
ENSDART00000132670 Essential Splice Site 188 262 5 6
Genomic Location (Zv9):
Chromosome 22 (position 41193732)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38281371
KASP Assay ID:
554-3175.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGAGACACAGGTGTGTGGTGGGGTAAATGTGTGTGTTGTGTGTTTTGC[A/T]GTGGGTTGTGGGTCCGTCGTACTTTGTGGAGTTCATCGTTCAAGAGAGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link