kitlga

Ensembl ID:
ENSDARG00000070917
ZFIN ID:
ZDB-GENE-070424-1
Description:
Kit ligand a [Source:UniProtKB/TrEMBL;Acc:Q56JH6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24647 Nonsense Available for shipment Available now
sa44268 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104502 Nonsense 42 271 3 9
ENSDART00000113581 Nonsense 43 272 3 10
ENSDART00000140484   None 88 None 5
Genomic Location (Zv9):
Chromosome 25 (position 18615162)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18031472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGACTGGCTTTTTTATGATTTTCTTTTTCTGTGTCTCCGATTAGAAA[C/T]AGAATATTCCAAAAGACTACAAGATTACAGTGCGTTATATACCTAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104502 Essential Splice Site 262 271 None 9
ENSDART00000113581 Essential Splice Site 263 272 None 10
ENSDART00000140484 Essential Splice Site 79 88 None 5
Genomic Location (Zv9):
Chromosome 25 (position 18607902)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18024212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTATACTGAGTTGTTTCTTGTATACTAACTTCCTGTTTTCTTTTCCC[A/T]GAAACAGATTAAATATTATCATGGATGTGTAAATCCAGCCCCAGCTTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link