dusp6

Ensembl ID:
ENSDARG00000070914
ZFIN ID:
ZDB-GENE-030613-1
Description:
dual specificity protein phosphatase 6 [Source:RefSeq peptide;Acc:NP_919361]
Human Orthologue:
DUSP6
Human Description:
dual specificity phosphatase 6 [Source:HGNC Symbol;Acc:3072]
Mouse Orthologue:
Dusp6
Mouse Description:
dual specificity phosphatase 6 Gene [Source:MGI Symbol;Acc:MGI:1914853]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24648 Nonsense Available for shipment Available now
sa39479 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104496 Nonsense 22 382 1 3

The following transcripts of ENSDARG00000070914 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 18817291)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18233601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCCGTGCAGATCGATTCGGTCATGGCCATAAGCAAGACGGTAGAGTG[G/A]CTGAAGGAGCAGCTAGAAACGCGCAGAGACTGTTTGCTCGTTATGGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104496 Nonsense 380 382 3 3

The following transcripts of ENSDARG00000070914 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 18814931)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18231241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACTTCACCACACCAACCAATCACAACGTTTTTCAGTTGGACCCTCTC[G/T]AGTCCACGTGAGGTCCTGCCATGACTTGATTCGAGTGAAATGCAAGTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link