met

Ensembl ID:
ENSDARG00000070903
ZFIN ID:
ZDB-GENE-041014-1
Description:
met proto-oncogene (hepatocyte growth factor receptor) [Source:RefSeq peptide;Acc:NP_001007125]
Human Orthologue:
MET
Human Description:
met proto-oncogene (hepatocyte growth factor receptor) [Source:HGNC Symbol;Acc:7029]
Mouse Orthologue:
Met
Mouse Description:
met proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:96969]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18672 Nonsense Available for shipment Available now
sa16304 Nonsense Available for shipment Available now
sa17944 Nonsense Available for shipment Available now
sa24650 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104461 Nonsense 241 1382 1 20
Genomic Location:
Chromosome 25 (position 19075350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCCGAKCAGTCCTACATGGATTTRGCCCCTTCACTGCGGGGGAACTA[T/A]CCACTACATTATGTCTACTCTTTCCAGAGTGGTCCTTATGTWTATTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104461 Nonsense 547 1382 4 20
Genomic Location:
Chromosome 25 (position 19117842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGGGYTGTGGATGGTGCAGGACCAGCAACCKGTGCACCAGGGCCCCT[C/T]RATRCCCCCAGTCCCAATGGATCCAGGACTCCTGCCCCCTCCYCATCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104461 Nonsense 592 1382 5 20
Genomic Location:
Chromosome 25 (position 19119964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCAAYATCACAATCTGTGGCAAAWACTTTGGCTTTAACAAAAAAGAC[A/T]GATTTGATACCAAACTKRTAGACGTGGTGGTTGCTGGAACGAAGTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104461 Nonsense 645 1382 6 20
Genomic Location:
Chromosome 25 (position 19121986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCAGCGTGGACTCTGTGGTCACAGTGCGCAGTGGCAAGGAACAGGCC[C/T]AGAAAGATGGCTTCTCATTTGTGGTAAGAGTCATCACAAATCACAGTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d546dnry