ppt2

Ensembl ID:
ENSDARG00000070883
ZFIN ID:
ZDB-GENE-010430-4
Description:
lysosomal thioesterase PPT2 [Source:RefSeq peptide;Acc:NP_001103329]
Human Orthologue:
PPT2
Human Description:
palmitoyl-protein thioesterase 2 [Source:HGNC Symbol;Acc:9326]
Mouse Orthologue:
Ppt2
Mouse Description:
palmitoyl-protein thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:1860075]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43254 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6550 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36813 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104421 Essential Splice Site 130 298 3 9
ENSDART00000125696 Essential Splice Site 130 169 3 5
Genomic Location (Zv9):
Chromosome 19 (position 18436056)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19281291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACACTCTTTTATATCTCTGTCTGCTCCACAGGCAGGACAGTATGGAGG[T/C]AACCCACTTTTTAGTTCTGCTGAGGAACACATTTAAAACATGCTGACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104421 Essential Splice Site 166 298 4 9
ENSDART00000125696 Essential Splice Site 166 169 4 5
ENSDART00000104421 Essential Splice Site 166 298 4 9
ENSDART00000125696 Essential Splice Site 166 169 4 5
Genomic Location (Zv9):
Chromosome 19 (position 18435787)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19281022
KASP Assay ID:
554-5450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTATACTGCAGTGGGCCAGAAAATATCAATCTGTAAYTACTGGAATGG[T/C]GAGTATGGATTGATCATGCATGTCATATTTAAAGTAAGAGAGAGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104421 Essential Splice Site 166 298 4 9
ENSDART00000125696 Essential Splice Site 166 169 4 5
ENSDART00000104421 Essential Splice Site 166 298 4 9
ENSDART00000125696 Essential Splice Site 166 169 4 5
Genomic Location (Zv9):
Chromosome 19 (position 18435787)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19281022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTATACTGCAGTGGGCCAGAAAATATCAATCTGTAACTACTGGAATGG[T/A]GAGTATGGATTGATCATGCATGTCATATTTAAAGTAAGAGAGAGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104421 Nonsense 197 298 6 9
ENSDART00000125696   None 169 None 5
Genomic Location (Zv9):
Chromosome 19 (position 18434339)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19279574
KASP Assay ID:
554-1500.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACATTTCTGGTTTGTGATGTTTTTGTTTTACTTGAACAGCTTGGAAA[C/T]AAAACTTTCTGCGTATTAAGAAGCTAGTACTGATTGGYGGCCCTGATGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pulmonary function: Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function. (View Study)
  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link