cspg5b

Ensembl ID:
ENSDARG00000070863
ZFIN ID:
ZDB-GENE-060503-368
Description:
chondroitin sulfate proteoglycan 5 (neuroglycan C) [Source:RefSeq peptide;Acc:NP_001038357]
Human Orthologue:
CSPG5
Human Description:
chondroitin sulfate proteoglycan 5 (neuroglycan C) [Source:HGNC Symbol;Acc:2467]
Mouse Orthologue:
Cspg5
Mouse Description:
chondroitin sulfate proteoglycan 5 Gene [Source:MGI Symbol;Acc:MGI:1352747]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5646 Nonsense Mutation detected in F1 DNA During 2014
sa4089 Nonsense Mutation detected in F1 DNA During 2014
sa8522 Nonsense Mutation detected in F1 DNA During 2014
sa11063 Nonsense Available for shipment Available now
sa16392 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108819 Nonsense 125 540 2 6
ENSDART00000140611 Nonsense 125 481 2 5
ENSDART00000108819 Nonsense 125 540 2 6
ENSDART00000140611 Nonsense 125 481 2 5

The following transcripts of ENSDARG00000070863 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 18901475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATAGGTGGCATAGCTGCCCGRCTGCCCACTCTAGCTGAATCCCAAAAA[C/T]GAGSACTGTTCCAGCTAGATTTTAATGAGGAGGGAAKGCAAGACAGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108819 Nonsense 125 540 2 6
ENSDART00000140611 Nonsense 125 481 2 5
ENSDART00000108819 Nonsense 125 540 2 6
ENSDART00000140611 Nonsense 125 481 2 5

The following transcripts of ENSDARG00000070863 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 18901475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATAGGTGGCATAGCTGCCCGRCTGCCCACTCTAGCTGAATCCCAAAAA[C/T]GAGSACTGTTCCAGCTAGATTTTAATGAGGAGGGAAKGCAAGACAGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108819 Nonsense 265 540 2 6
ENSDART00000140611 Nonsense 265 481 2 5

The following transcripts of ENSDARG00000070863 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 18901055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCAACACAGGGGTTGTTGATTATAGTGGATCTGGAGAAAGTTTACCC[G/T]GAGCAGCGAATGTRCTTGGCAACTCTGGTTGTCTTCTTGGATTTGTGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108819 Nonsense 328 540 3 6
ENSDART00000140611 Nonsense 328 481 3 5

The following transcripts of ENSDARG00000070863 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 18891247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTRTAGGTGCAACATTCAGGAGTATATCTGGAACAAGGGCTCCAGGTG[T/A]GAATCAGTCATTTCAGATTTCCAAGTGATGTGTATAGCCGTGGGTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108819 Nonsense 391 540 4 6
ENSDART00000140611 Nonsense 391 481 4 5

The following transcripts of ENSDARG00000070863 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 18884408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTTCAGTAAGTACCGTCCAAAGTCGGAGCAGCACATTGATAACTTCT[C/A]GCTGTCCACTGTTGCAGAGGRCTCTCAGGCAAACGTAAGGAAACTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vmnw81tw