LOC562799

Ensembl ID:
ENSDARG00000070843
Human Orthologue:
ARID3A
Human Description:
AT rich interactive domain 3A (BRIGHT-like) [Source:HGNC Symbol;Acc:3031]
Mouse Orthologue:
Arid3a
Mouse Description:
AT rich interactive domain 3A (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1328360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21842 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104358 Nonsense 397 528 6 8
Genomic Location:
Chromosome 11 (position 5838390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGTAGCTGCAGCACAGGCCGCGGCTGCACAAGCGGCCACCATCGCA[C/T]AGGTAGCTGCTCTGGAGCAGCTGCGGGATAACCTGGAGACCGGCGAACCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e3bls3j7