tnnc2

Ensembl ID:
ENSDARG00000070835
ZFIN ID:
ZDB-GENE-000322-2
Description:
troponin C, fast skeletal [Source:RefSeq peptide;Acc:NP_571638]
Human Orthologue:
TNNC2
Human Description:
troponin C type 2 (fast) [Source:HGNC Symbol;Acc:11944]
Mouse Orthologue:
Tnnc2
Mouse Description:
troponin C2, fast Gene [Source:MGI Symbol;Acc:MGI:98780]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8006 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104336 None None 160 None 6
ENSDART00000144047 Essential Splice Site None 145 2 6
Genomic Location:
Chromosome 23 (position 20712627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGTTATAAAACATGTAATTCAGTACATCAAAAAAAAAACTATATTT[A/T]GGCCATCTGATACTAACCATTCATAATGTAACAACSTGTTGTTTCACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/17n6nm74