actl6a

Ensembl ID:
ENSDARG00000070828
ZFIN ID:
ZDB-GENE-020419-36
Description:
actin-like protein 6A [Source:RefSeq peptide;Acc:NP_775347]
Human Orthologue:
ACTL6A
Human Description:
actin-like 6A [Source:HGNC Symbol;Acc:24124]
Mouse Orthologue:
Actl6a
Mouse Description:
actin-like 6A Gene [Source:MGI Symbol;Acc:MGI:1861453]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8548 Nonsense Mutation detected in F1 DNA During 2016
sa40709 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104303 Nonsense 130 429 5 14
ENSDART00000130813 Nonsense 130 428 5 17

The following transcripts of ENSDARG00000070828 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 29104071)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29399714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATTTGACTCACGCRATCTTGATTTGTTCATCCKGCAGTGGAACACA[C/T]GAGCGAARAGAGAGAAGCTGACGGAGCTGATGTTTGAGCATTACAAMATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104303 Essential Splice Site 277 429 9 14
ENSDART00000130813 Essential Splice Site 276 428 12 17

The following transcripts of ENSDARG00000070828 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 29105545)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29401188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGGCCTCTGTGCTTCAGGTGTCAGATTCACCCTATGATGAACAG[T/C]AAGCTCAGTTTCTTTCCTTTCACTAATACAGCTTAAATAGCTTGTGGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link