pax7b

Ensembl ID:
ENSDARG00000070818
ZFIN IDs:
ZDB-GENE-080917-54, ZDB-GENE-990415-201, ZDB-GENE-990415-201, ZDB-GENE-990415-201
Description:
paired box gene 7b [Source:RefSeq peptide;Acc:NP_001139621]
Human Orthologue:
PAX7
Human Description:
paired box 7 [Source:HGNC Symbol;Acc:8621]
Mouse Orthologue:
Pax7
Mouse Description:
paired box gene 7 Gene [Source:MGI Symbol;Acc:MGI:97491]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15267 Essential Splice Site Available for shipment Available now
sa16225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097138   None 280 None 7
ENSDART00000104288 Essential Splice Site 266 395 7 9
ENSDART00000129992 Essential Splice Site 269 510 6 9
Genomic Location (Zv9):
Chromosome 23 (position 21191118)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20975781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTATTTGCTTATTAATATTAAATTAATATATTTTTCCTCTAAATGTC[A/G]GGTTTGRTTCAGCAATCGTCGAGCCAGGTGGCGCAAACAAGCTGGAGYAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097138   None 280 None 7
ENSDART00000104288 Nonsense 267 395 7 9
ENSDART00000129992 Nonsense 270 510 6 9
Genomic Location (Zv9):
Chromosome 23 (position 21191125)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20975788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTTATTAATATTAAATTAATATATTTTTCCTCTAAATGTCRGGTTTG[G/A]TTCAGCAATCGTCGAGCCAGGTGGCGCAAACAAGCTGGAGYAAATCAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Orofacial clefts: Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. (View Study)
  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link