ENSDARG00000070813

Ensembl ID:
ENSDARG00000070813
Human Orthologues:
AL512662.2, MBL2, SFTPA1, SFTPA2, SFTPD
Human Descriptions:
mannose-binding lectin (protein C) 2, soluble (opsonic defect) [Source:HGNC Symbol;Acc:6922]
surfactant protein A1 [Source:HGNC Symbol;Acc:10798]
surfactant protein A2 [Source:HGNC Symbol;Acc:10799]
surfactant protein D [Source:HGNC Symbol;Acc:10803]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B5MCL0]
Mouse Orthologues:
Mbl1, Mbl2, Sftpa1, Sftpd
Mouse Descriptions:
mannose-binding lectin (protein A) 1 Gene [Source:MGI Symbol;Acc:MGI:96923]
mannose-binding lectin (protein C) 2 Gene [Source:MGI Symbol;Acc:MGI:96924]
surfactant associated protein A1 Gene [Source:MGI Symbol;Acc:MGI:109518]
surfactant associated protein D Gene [Source:MGI Symbol;Acc:MGI:109515]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15570 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075931 Nonsense 166 204 3 4
Genomic Location:
Chromosome 6 (position 29531408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGATGGGTGACATTAGTTTTGCAAAGAACTCTTTTAGAAAACATTGCAT[T/A]ACTGAAACWATTASTATCCWGTGATTTTAATAAGAAGCCATTTATTAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s1h4m7hw