
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC100004008
- Ensembl ID:
- ENSDARG00000070812
- Human Orthologue:
- RBBP6
- Human Description:
- retinoblastoma binding protein 6 [Source:HGNC Symbol;Acc:9889]
- Mouse Orthologues:
- AC099701.1, AC158570.1, Gm9343, Rbbp6
- Mouse Descriptions:
- predicted gene 9343 Pseudogene [Source:MGI Symbol;Acc:MGI:3645198]
- retinoblastoma binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:894835]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41793 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41793
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108681 | Essential Splice Site | None | 174 | None | 6 |
ENSDART00000112677 | Essential Splice Site | 221 | 278 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 11 (position 12239018)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 12234759 GRCz11 11 12218380 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAAATCTCACATTATGTCTGCTTGTGTGTGTTTGCGCTCGATCTGTTC[A/C]GTGAGGCCTATGCTGCTGAGAAGAAAAAGAGGCCGTCCTTCTCCTGCCAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Brain structure: Voxelwise genome-wide association study (vGWAS). (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: