si:ch73-138e9.1

Ensembl ID:
ENSDARG00000070810
ZFIN ID:
ZDB-GENE-100922-79
Human Orthologue:
CCK
Human Description:
cholecystokinin [Source:HGNC Symbol;Acc:1569]
Mouse Orthologue:
Cck
Mouse Description:
cholecystokinin Gene [Source:MGI Symbol;Acc:MGI:88297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8761 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104278 Nonsense 118 127 2 2
ENSDART00000134202 Nonsense 114 123 3 3
Genomic Location (Zv9):
Chromosome 16 (position 7034711)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5879242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACAGAATAAAGGACAGAGATTACTTGGGATGGATGGATTTTGGCCGA[C/T]GAAGCGCCGAGGARTATGAATACTCCTCATAAGACCCATTCAACYGATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link