cbx4

Ensembl ID:
ENSDARG00000070807
ZFIN ID:
ZDB-GENE-040329-2
Description:
chromobox homolog 4 [Source:RefSeq peptide;Acc:NP_991312]
Human Orthologue:
CBX4
Human Description:
chromobox homolog 4 [Source:HGNC Symbol;Acc:1554]
Mouse Orthologue:
Cbx4
Mouse Description:
chromobox homolog 4 (Drosophila Pc class) Gene [Source:MGI Symbol;Acc:MGI:1195985]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19977 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104272 Essential Splice Site 24 477 2 5
ENSDART00000104273 Essential Splice Site 24 145 2 6
ENSDART00000122836 Essential Splice Site 24 477 2 5
ENSDART00000124080 None None 145 None 6
ENSDART00000125749 None None 477 None 5
Genomic Location:
Chromosome 3 (position 18285392)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCATATGTTGTTCCTGTACACCCAACCACGTTTTATGTCGTTTTTTC[A/G]GGGTAGAATGGAGTATCTGGTGAAGTGGAGAGGATGGTCACCCAAGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y1ltl0zk