NP_001071067.1

Ensembl ID:
ENSDARG00000070805
Description:
c-src tyrosine kinase [Source:RefSeq peptide;Acc:NP_001071067]
Human Orthologue:
CSK
Human Description:
c-src tyrosine kinase [Source:HGNC Symbol;Acc:2444]
Mouse Orthologue:
Csk
Mouse Description:
c-src tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:88537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32531 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104271 Essential Splice Site 81 450 4 13
Genomic Location (Zv9):
Chromosome 25 (position 21278138)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20533693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGAAGAGAGAAGGAGTAAAGTCCGCCAGCAAACTGAGCCTTATGCC[G/A]TAAGTACGCCGTTCATTTGCCTGCACTTTTTGTCTTCACAGATGTACACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link