eaf1

Ensembl ID:
ENSDARG00000070795
ZFIN ID:
ZDB-GENE-040625-109
Description:
ELL-associated factor 1 [Source:RefSeq peptide;Acc:NP_001002115]
Human Orthologue:
EAF1
Human Description:
ELL associated factor 1 [Source:HGNC Symbol;Acc:20907]
Mouse Orthologue:
Eaf1
Mouse Description:
ELL associated factor 1 Gene [Source:MGI Symbol;Acc:MGI:1921677]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13760 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104252 Nonsense 168 253 4 6
ENSDART00000144763 Nonsense 168 227 5 6

The following transcripts of ENSDARG00000070795 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 8161625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCTACCAAAGAYAACCCTTCACCAGAGCCTCAGCTGGACGACATCAAA[C/T]GAGGTCAGAYATTCACACTCGCWATTATACCATAGTGTGCTTAATGCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kmjzi3by