lrrc15

Ensembl ID:
ENSDARG00000070792
ZFIN ID:
ZDB-GENE-031113-8
Description:
leucine-rich repeat-containing protein 15 [Source:RefSeq peptide;Acc:NP_001074151]
Human Orthologue:
LRRC15
Human Description:
leucine rich repeat containing 15 [Source:HGNC Symbol;Acc:20818]
Mouse Orthologue:
Lrrc15
Mouse Description:
leucine rich repeat containing 15 Gene [Source:MGI Symbol;Acc:MGI:1921738]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20746 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104248 Nonsense 253 564 2 2
ENSDART00000145753 None None 178 None 3
Genomic Location:
Chromosome 6 (position 36241026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCGCAAAAGTGCAGAAGCTAAAGAAACTCTACCTCTCCAGCAATAGGT[T/A]ATCATTGCTTCCCAGTGGAATCTTTCTGAATCTTCCCAACCTTACTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9fdbt0gw