jup

Ensembl ID:
ENSDARG00000070787
ZFIN ID:
ZDB-GENE-991207-22
Description:
junction plakoglobin [Source:RefSeq peptide;Acc:NP_571252]
Human Orthologue:
JUP
Human Description:
junction plakoglobin [Source:HGNC Symbol;Acc:6207]
Mouse Orthologues:
AC165274.1, Jup
Mouse Description:
junction plakoglobin Gene [Source:MGI Symbol;Acc:MGI:96650]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12961 Essential Splice Site Available for shipment Available now
sa31818 Nonsense Available for shipment Available now
sa14171 Essential Splice Site Available for shipment Available now
sa12692 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Essential Splice Site 580 729 12 16
ENSDART00000081018   None 390 None 11
ENSDART00000130644 Essential Splice Site None 390 13 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 11894981)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11789984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCYATCCGGACATGGTTAGAGTATAAGACATGCTTTCTGTTCGTGCA[G/A]CTGTTGTATTCTCCACTGGATAACRTCAAGCGTGTGGCAGCTGGTGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Nonsense 620 729 12 16
ENSDART00000081018   None 390 None 11
ENSDART00000130644   None 390 13 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 11895102)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11790105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGTCGGCTGAGATCATCGATGCGGAAGGAGCCAGTGCTCCTCTCATG[G/T]AGCTCCTTCACTCCAGCAACGAAGGGATCGGTGAGTGAGAGAGAATCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Essential Splice Site 670 729 None 16
ENSDART00000081018   None 390 None 11
ENSDART00000130644 Essential Splice Site None 390 None 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 11896953)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11791956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACTCACACACTCACTCTTCAAACAYGACCCTGAGGCTTGGGAAATGG[T/A]GAGTTTGCCCTCTRSTGCTGTGGAGCTGTCATAACAGAAATATGTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Essential Splice Site 684 729 None 16
ENSDART00000081018   None 390 None 11
ENSDART00000130644 Essential Splice Site None 390 None 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 11898677)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11793680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTTTAGGCACACAACACTGTGATGGATCCCGTCCTTGGCGATGAAGG[T/G]CAGTAGTGTCCTTATCAAGAATGTTCCATTCAGTTCTCTCCATGTSTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link