jup

Ensembl ID:
ENSDARG00000070787
ZFIN ID:
ZDB-GENE-991207-22
Description:
junction plakoglobin [Source:RefSeq peptide;Acc:NP_571252]
Human Orthologue:
JUP
Human Description:
junction plakoglobin [Source:HGNC Symbol;Acc:6207]
Mouse Orthologues:
AC165274.1, Jup
Mouse Description:
junction plakoglobin Gene [Source:MGI Symbol;Acc:MGI:96650]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7665 Nonsense Mutation detected in F1 DNA During 2014
sa3809 Nonsense Mutation detected in F1 DNA During 2014
sa19001 Nonsense Mutation detected in F1 DNA During 2014
sa12961 Essential Splice Site Available for shipment Available now
sa14171 Essential Splice Site Available for shipment Available now
sa12692 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Nonsense 51 729 3 16
ENSDART00000081018 Nonsense 51 390 3 11
ENSDART00000130644 Nonsense 51 390 3 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 11874711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCGCTCAGATGATGATGGAACAGAGTACAGCTCTAAGAAATTCACCTA[C/A]ACCAYCACATTCACAGAGAACCCTGCAGGTGAGAAGACACAATCATAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Nonsense 420 729 9 16
ENSDART00000081018 None None 390 None 11
ENSDART00000130644 None None 390 10 17
ENSDART00000003891 Nonsense 420 729 9 16
ENSDART00000081018 None None 390 None 11
ENSDART00000130644 None None 390 10 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 11890215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTCCAAYCTCACCTGCAACAACACACGCAACAAAACGCAGGTRACC[C/T]AGAGTAAYGGCGTRGAGGCTCTYATTCACACCATCCTGAGGGCCAGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Nonsense 420 729 9 16
ENSDART00000081018 None None 390 None 11
ENSDART00000130644 None None 390 10 17
ENSDART00000003891 Nonsense 420 729 9 16
ENSDART00000081018 None None 390 None 11
ENSDART00000130644 None None 390 10 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 11890215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTCCAATCTCACCTGCAACAACACACGCAACAAAACGCAGGTAACC[C/T]AGAGTAATGGCGTGGAGGCTCTCATTCACACCATCCTGAGGGCCAGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Essential Splice Site 580 729 12 16
ENSDART00000081018 None None 390 None 11
ENSDART00000130644 Essential Splice Site None 390 13 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 11894981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCYATCCGGACATGGTTAGAGTATAAGACATGCTTTCTGTTCGTGCA[G/A]CTGTTGTATTCTCCACTGGATAACRTCAAGCGTGTGGCAGCTGGTGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Essential Splice Site 670 729 None 16
ENSDART00000081018 None None 390 None 11
ENSDART00000130644 Essential Splice Site None 390 None 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 11896953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACTCACACACTCACTCTTCAAACAYGACCCTGAGGCTTGGGAAATGG[T/A]GAGTTTGCCCTCTRSTGCTGTGGAGCTGTCATAACAGAAATATGTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003891 Essential Splice Site 684 729 None 16
ENSDART00000081018 None None 390 None 11
ENSDART00000130644 Essential Splice Site None 390 None 17

The following transcripts of ENSDARG00000070787 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 11898677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTTTAGGCACACAACACTGTGATGGATCCCGTCCTTGGCGATGAAGG[T/G]CAGTAGTGTCCTTATCAAGAATGTTCCATTCAGTTCTCTCCATGTSTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jbmr9fj0