si:ch73-277l12.1

Ensembl ID:
ENSDARG00000070786
ZFIN ID:
ZDB-GENE-030131-1505
Human Orthologue:
ZNF473
Human Description:
zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
Mouse Orthologue:
Zfp473
Mouse Description:
zinc finger protein 473 Gene [Source:MGI Symbol;Acc:MGI:2442697]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29316 Nonsense Mutation detected in F1 DNA During 2017
sa29315 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa16733 Nonsense Available for shipment Available now
sa14444 Nonsense Available for shipment Available now
sa36985 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104244 Nonsense 187 610 2 5
ENSDART00000130600 Nonsense 129 511 3 8
ENSDART00000134439 Nonsense 303 1197 3 3
Genomic Location (Zv9):
Chromosome 20 (position 10247800)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10073474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTGTGAAATATGCTTGAAGGTATTTAGTGTCTTCTCTAATCTAAAA[C/T]GACATCGGTTTGTTCACTTAGCCTCCAAGCCTTACACTTGCACAATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104244 Missense 301 610 3 5
ENSDART00000130600 Essential Splice Site 253 511 None 8
ENSDART00000134439 Missense 492 1197 3 3
Genomic Location (Zv9):
Chromosome 20 (position 10247233)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10072907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGTATCATTTGCGGAGGCACCAGAAGATCCACAAAAGAGAAAAAAAG[T/C]ATATTGCCAACAAAACAGGGCATCAATTACTCTATTCTTCTAATGTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104244 Nonsense 436 610 4 5
ENSDART00000130600 Nonsense 321 511 6 8
ENSDART00000134439 Nonsense 683 1197 3 3
Genomic Location (Zv9):
Chromosome 20 (position 10246658)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10072332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGTAATGATGAGAATCAGTGCGTCATCTGTCTGAAGACCTTTCCATA[T/A]CMGTCTAAGCTCTCCAGACATCTTTTGACCCACACAGATTTCAAACCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104244   None 610 None 5
ENSDART00000130600   None 511 None 8
ENSDART00000134439 Nonsense 833 1197 3 3
Genomic Location (Zv9):
Chromosome 20 (position 10246210)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10071884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGATGAAAATCAAAGCCAAAATTTATCTGATGTTTCATCAGATACT[G/T]AAACACAGACTCCAGGAAACTCCAGCCCAATGTACCCTGAGTCCAGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104244   None 610 None 5
ENSDART00000130600   None 511 None 8
ENSDART00000134439 Nonsense 931 1197 3 3
Genomic Location (Zv9):
Chromosome 20 (position 10245916)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10071590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCACAACAGGACTGTGCAGATTCTGGAAAAGCTGTCGCATCTAAAGAC[C/T]AAGATCTGAAAATGCCATCGTCTCAAGATGGAGCTACAGTTCACCAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link