rln3a

Ensembl ID:
ENSDARG00000070780
ZFIN ID:
ZDB-GENE-050310-3
Description:
relaxin 3a [Source:RefSeq peptide;Acc:NP_001032892]
Human Orthologue:
RLN3
Human Description:
relaxin 3 [Source:HGNC Symbol;Acc:17135]
Mouse Orthologue:
Rln3
Mouse Description:
relaxin 3 Gene [Source:MGI Symbol;Acc:MGI:2158015]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15534 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087803 Nonsense 125 152 2 2
Genomic Location:
Chromosome 3 (position 19032254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKCGCTCTCTCATTTCAGAGGAGGTGCTTGAGGCACTGCGGAGYGTRGAC[A/T]GAAAGGGACGGGATGTGRTGGTGGGACTGTCCAACGCCTGCTGCAAATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ltidaj8o