irgf1

Ensembl ID:
ENSDARG00000070774
ZFIN ID:
ZDB-GENE-051212-5
Description:
immunity-related GTPase family, f1 [Source:RefSeq peptide;Acc:NP_001108170]
Human Orthologues:
IRGC, IRGM
Human Descriptions:
immunity-related GTPase family, cinema [Source:HGNC Symbol;Acc:28835]
immunity-related GTPase family, M [Source:HGNC Symbol;Acc:29597]
Mouse Orthologues:
9930111J21Rik1, 9930111J21Rik2, AC132320.1, BC023105, Gm12185, Gm4841, Gm4951, Gm5431, Ifi47, Igtp, Iigp1, Irgc1, Irgm1, Irgm2, Tgtp1, Tgtp2
Mouse Descriptions:
cDNA sequence BC023105 Pseudogene [Source:MGI Symbol;Acc:MGI:2384767]
immunity-related GTPase family M member 1 Gene [Source:MGI Symbol;Acc:MGI:107567]
immunity-related GTPase family M member 2 Gene [Source:MGI Symbol;Acc:MGI:1926262]
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma induced GTPase Gene [Source:MGI Symbol;Acc:MGI:107729]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
interferon inducible GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:1926259]
interferon-inducible GTPase-like [Source:RefSeq peptide;Acc:NP_001094945]
predicted gene 12185 Gene [Source:MGI Symbol;Acc:MGI:3652173]
predicted gene 4841 Gene [Source:MGI Symbol;Acc:MGI:3643814]
predicted gene 4951 Gene [Source:MGI Symbol;Acc:MGI:3644953]
predicted gene 5431 Gene [Source:MGI Symbol;Acc:MGI:3645205]
RIKEN cDNA 9930111J21 gene 1 Gene [Source:MGI Symbol;Acc:MGI:3041173]
RIKEN cDNA 9930111J21 gene 2 Gene [Source:MGI Symbol;Acc:MGI:3711310]
T-cell specific GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:98734]
T-cell specific GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:3710083]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7456 Missense Mutation detected in F1 DNA During 2017
sa15 Nonsense Confirmed mutation in F2 line During 2017
sa23522 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104220 Missense 129 398 2 4
ENSDART00000134567 Missense 129 398 2 3
Genomic Location (Zv9):
Chromosome 19 (position 23784685)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23714100
KASP Assay ID:
554-4086.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGATGAGTATCTCGAGTTGGTTGAGTTTGAGCGCTATGATTTTTTCAT[T/G]ATCATCGCTTCAGATAGATTYAGAGAATGCCACACTCAGCTGGCCAAAGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104220 Nonsense 137 398 2 4
ENSDART00000134567 Nonsense 137 398 2 3
Genomic Location (Zv9):
Chromosome 19 (position 23784707)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23714122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGTTTGAGCGCTATGATTTTTTCATTATCATCGCTTCAGATAGATTT[A/T]GAGAATGCCACACTCAGCTGGCCAAAGAGATCATGAGGATGGGGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104220 Nonsense 207 398 3 4
ENSDART00000134567 Nonsense 207 398 3 3
Genomic Location (Zv9):
Chromosome 19 (position 23785098)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23714513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAGAAAGATCGGTATAGAAGATCCCATTGTATTCCTGATCTCAGGCT[G/A]GGAGCTCAGCAAGTATGATTTAAATCTGCTGCAGGATAGAATGGAGAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Crohn's disease: Sequence variants in the autophagy gene IRGM and multiple other replicating loci contribute to Crohn's disease susceptibility. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link