foxg1a

Ensembl ID:
ENSDARG00000070769
ZFIN ID:
ZDB-GENE-990415-267
Description:
forkhead box protein G1 [Source:RefSeq peptide;Acc:NP_571142]
Human Orthologue:
FOXG1
Human Description:
forkhead box G1 [Source:HGNC Symbol;Acc:3811]
Mouse Orthologues:
3110039M20Rik, Foxg1
Mouse Descriptions:
forkhead box G1 Gene [Source:MGI Symbol;Acc:MGI:1347464]
RIKEN cDNA 3110039M20 gene Gene [Source:MGI Symbol;Acc:MGI:1914543]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23103 Nonsense Mutation detected in F1 DNA During 2014
sa15987 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104204 Nonsense 29 420 1 1
Genomic Location:
Chromosome 17 (position 29178185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTCCTAAATCATCGTTCAGTATAAACAGTCTGGTTCCCGAAGCCGTG[C/T]AAAGCGACAACCACCATCACCACCACCACCAGCAACAACAACACCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104204 Nonsense 294 420 1 1
Genomic Location:
Chromosome 17 (position 29177389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCAAAACAGTTTGGGGAACAATCACTCTTTCCCGGCCTCAAATGGCT[T/A]GAGTGTTGACAGACTCGTAAATGGAGAGATTCCGTACGCCACACACCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1tpvnpih