gabra5

Ensembl ID:
ENSDARG00000070730
ZFIN ID:
ZDB-GENE-081104-30
Human Orthologue:
GABRA5
Human Description:
gamma-aminobutyric acid (GABA) A receptor, alpha 5 [Source:HGNC Symbol;Acc:4079]
Mouse Orthologue:
Gabra5
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit alpha 5 Gene [Source:MGI Symbol;Acc:MGI:95617]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7585 Missense Mutation detected in F1 DNA During 2017
sa8377 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104135 Missense 319 491 8 10
ENSDART00000138026 Missense 281 453 9 11

The following transcripts of ENSDARG00000070730 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 38311923)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38383523
KASP Assay ID:
554-4210.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
STACATGCCGTGCTTCATGACTGTCATTCTGTCCCAAGTCTCATTCTGGC[T/C]CAACCGTGAATCCGTCCCAGCCAGGACTGTSTTTGGTCAGTACTTCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104135 Essential Splice Site 331 491 None 10
ENSDART00000138026 Essential Splice Site 293 453 None 11

The following transcripts of ENSDARG00000070730 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 38311886)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38383486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCATTCTGGCBCAACCGTGAATCCGTCCCAGCCAGGACTGWSTTTGG[T/G]CAGTACTTCCTTCTGCAMTTTATTTRTTTATTGTTTGTGGTAATTCAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link