CNGA3 (1 of 2)

Ensembl ID:
ENSDARG00000070726
Description:
cyclic nucleotide gated channel alpha 3 [Source:HGNC Symbol;Acc:2150]
Human Orthologue:
CNGA3
Human Description:
cyclic nucleotide gated channel alpha 3 [Source:HGNC Symbol;Acc:2150]
Mouse Orthologue:
Cnga3
Mouse Description:
cyclic nucleotide gated channel alpha 3 Gene [Source:MGI Symbol;Acc:MGI:1341818]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20756 Nonsense Available for shipment Available now
hu2132 Nonsense Confirmed mutation in F2 line Unknown
sa25344 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104124 Nonsense 210 609 4 4
Genomic Location:
Chromosome 6 (position 38727394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACCGTCTCTTCAAAATGGCACGTCTCTTTGAGTTCTTCGACCGCACA[G/T]AAACCCGAACAAACTACCCCAACATTTTCCGCATCAGCAACCTCGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2132
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104124 Nonsense 375 609 4 4
Genomic Location:
Chromosome 6 (position 38726898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCGACTACCTCTGGACGGAGAAGAAGACCTGCGACGAGAAGGAGGTAT[T/A]GAAGAATCTTCCAGACAAGCTCAAAGCAGAGATTGCCATCAACGTCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104124 Nonsense 600 609 4 4
Genomic Location:
Chromosome 6 (position 38726224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAATAAAGTGAAAACGCTGCGGCCTGAAGACCTGTCTGAGGTGATC[G/T]AGGACAAAAAGGAAGAGGAGAAGAAGACTAAATAGTAATCCGCATAGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/obv60pk7