ndufa9

Ensembl ID:
ENSDARG00000070723
ZFIN ID:
ZDB-GENE-050320-20
Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 [Source:RefSeq peptide;Acc:NP_001013477]
Human Orthologue:
NDUFA9
Human Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa [Source:HGNC Symbol;Acc:7693]
Mouse Orthologue:
Ndufa9
Mouse Description:
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 Gene [Source:MGI Symbol;Acc:MGI:1913358]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38039 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38039
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019413 Nonsense 357 374 11 11
ENSDART00000042739 Nonsense 225 242 7 7
ENSDART00000123352   None 308 12 12

The following transcripts of ENSDARG00000070723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 17129743)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16676287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCATCGAGCAGAAGGCCATTGAAACCTTGCGCCGCCATCGCCGTCAA[C/T]GATTCTTTGAAGCAGCGGTTGGAGAGGCCAAGCCCTCCAAAACAGTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link