im:7143718

Ensembl ID:
ENSDARG00000070717
ZFIN ID:
ZDB-GENE-041111-192
Human Orthologue:
SLC25A18
Human Description:
solute carrier family 25 (mitochondrial carrier), member 18 [Source:HGNC Symbol;Acc:10988]
Mouse Orthologue:
Slc25a18
Mouse Description:
solute carrier family 25 (mitochondrial carrier), member 18 Gene [Source:MGI Symbol;Acc:MGI:1919053]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10626 Essential Splice Site Available for shipment Available now
sa24635 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104110 Essential Splice Site 7 330 1 10
Genomic Location:
Chromosome 25 (position 16996877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGAAATCAGCTGAAGTYTGGCCAAAATGGCCGAAAAGAAACTGAGG[T/G]AAATCTTTGCTGTTCTCTGGTGATTTGAAGTTTCATCCCAAGCTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104110 Nonsense 45 330 2 10
Genomic Location:
Chromosome 25 (position 16996660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGATCTTGCTAAGACCCGCCTACAAAACCAGCAGGGAGCTCGTGTTTA[T/A]AGTGGAATGTGAGTACAGGATCTTTATGAGCTCCCAAAACGGTGTAGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f4102nzx