kbtbd8

Ensembl ID:
ENSDARG00000070698
ZFIN ID:
ZDB-GENE-030114-8
Description:
Kelch repeat and BTB domain-containing protein 8 [Source:UniProtKB/Swiss-Prot;Acc:Q08CL3]
Human Orthologue:
KBTBD8
Human Description:
kelch repeat and BTB (POZ) domain containing 8 [Source:HGNC Symbol;Acc:30691]
Mouse Orthologue:
Kbtbd8
Mouse Description:
kelch repeat and BTB (POZ) domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:2661430]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6201 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104072 Essential Splice Site 447 601 3 4
Genomic Location (Zv9):
Chromosome 11 (position 16966803)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 16447503
KASP Assay ID:
554-4823.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTTTCACAGCACAATAGAGTATAAGGACCGCATCTATGTGCTGCAAG[G/A]TGAGTGGGGTTATTGCAGAGTCACCTAAAATCAGGCTGTACAAATGCATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link