dkk3

Ensembl ID:
ENSDARG00000070683
ZFIN ID:
ZDB-GENE-061207-74
Description:
dickkopf-related protein 3 [Source:RefSeq peptide;Acc:NP_001083014]
Human Orthologue:
DKK3
Human Description:
dickkopf homolog 3 (Xenopus laevis) [Source:HGNC Symbol;Acc:2893]
Mouse Orthologue:
Dkk3
Mouse Description:
dickkopf homolog 3 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1354952]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1295 Nonsense F2 line generated During 2017
sa24628 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1295
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104043 Nonsense 13 283 1 7
Genomic Location (Zv9):
Chromosome 25 (position 16503813)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16050357
KASP Assay ID:
554-1210.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCTCAACGCGATGCTGAAATCGATGATATTGTGTCTCTGTGTGGGTT[T/G]AGCAGTGGGCAGTTCAGTTCACCGAGGCGCGCATCTGGACATCAGCGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104043 Essential Splice Site 67 283 2 7
Genomic Location (Zv9):
Chromosome 25 (position 16502365)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16048909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTCAAAATGTTCCTAATATGAATATTATTTGATAAATATGCACAATC[A/C]GATGGAGAACGAGACTACAAACTCACTGTTAAATGGACGCGACTTTCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link