sdf4

Ensembl ID:
ENSDARG00000070682
ZFIN ID:
ZDB-GENE-040426-2061
Description:
45 kDa calcium-binding protein [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUC2]
Human Orthologue:
SDF4
Human Description:
stromal cell derived factor 4 [Source:HGNC Symbol;Acc:24188]
Mouse Orthologue:
Sdf4
Mouse Description:
stromal cell derived factor 4 Gene [Source:MGI Symbol;Acc:MGI:108079]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15791 Essential Splice Site Available for shipment Available now
sa7507 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104031 Essential Splice Site None 356 1 7
Genomic Location (Zv9):
Chromosome 23 (position 24986406)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24772526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAWTCAWCTGACAGTTMATTTGTGGGAGAGACCTTTTAAACAAACGG[G/A]TAGGTAAATTGTTWATTATTTTYCATTCATAAGTGTCATCTTTTTTNCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104031 Missense 300 356 7 7
Genomic Location (Zv9):
Chromosome 23 (position 24982010)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24768130
KASP Assay ID:
554-4284.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATSCCATTTGAATGGATATCTGATATTGTCTCTGCTCGGCTCCACAGGAA[T/A]ACATGGACCCTATGAATGAGCACAACGCTCTKAATGAGGCCAAGCAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link