fezf2

Ensembl ID:
ENSDARG00000070677
ZFIN ID:
ZDB-GENE-001103-3
Description:
Fez family zinc finger protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q804Q5]
Human Orthologue:
FEZF2
Human Description:
FEZ family zinc finger 2 [Source:HGNC Symbol;Acc:13506]
Mouse Orthologue:
Fezf2
Mouse Description:
Fez family zinc finger 2 Gene [Source:MGI Symbol;Acc:MGI:1859823]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa178 Nonsense Available for shipment Available now
sa278 Nonsense F2 line generated During 2014
sa14758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103997 Nonsense 171 438 2 5
ENSDART00000130308 Nonsense 163 430 2 5
Genomic Location:
Chromosome 11 (position 20478041)
KASP Assay ID:
554-0048.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTATTTCAATTACCTGGACTCTGCTTATCAGTCTGAGCTGCTGAGT[G/T]GACATTTATTTTCTTCGGCAATCGCGAACTCTCAAGCACAAGCCATAAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa278
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103997 Nonsense 191 438 2 5
ENSDART00000130308 Nonsense 183 430 2 5
Genomic Location:
Chromosome 11 (position 20478101)
KASP Assay ID:
554-2891.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTCGGCAATCGCGAACTCTCAAGCACAAGCCATAAGCGCKCATCAG[A/T]AGCTCCTCTTGTTGGAGAACGCTAAACTTGCTTGCGTTTCTCCTGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103997 Nonsense 356 438 5 5
ENSDART00000130308 Nonsense 348 430 5 5
Genomic Location:
Chromosome 11 (position 20479175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAGAGAAAAAACTTACANNNNTATTTTGTTCTTTTTTCAGGGAATTA[C/A]AAGAASCACAAACTAACCCACAGCGGCGAGAAACAGTACAAGTGTTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7ig4f1oj