ifnphi3

Ensembl ID:
ENSDARG00000070676
ZFIN ID:
ZDB-GENE-071128-2
Description:
interferon phi 3 [Source:RefSeq peptide;Acc:NP_001104553]
Human Orthologues:
IFNB1, IFNE, IFNK, IFNW1
Human Descriptions:
interferon, beta 1, fibroblast [Source:HGNC Symbol;Acc:5434]
interferon, epsilon [Source:HGNC Symbol;Acc:18163]
interferon, kappa [Source:HGNC Symbol;Acc:21714]
interferon, omega 1 [Source:HGNC Symbol;Acc:5448]
Mouse Orthologues:
Gm13271, Gm13275, Gm13276, Gm13283, Gm13288, Gm13290, Ifnb1, Ifne, Ifnk, Ifnz, RP23-139P14.14, RP23-139P14.15, RP23-139P14.16, RP23-139P14.19, RP23-139P14.20, RP23-139P14.22, RP23-139P14.23
Mouse Descriptions:
interferon beta 1, fibroblast Gene [Source:MGI Symbol;Acc:MGI:107657]
interferon epsilon Gene [Source:MGI Symbol;Acc:MGI:2667156]
interferon kappa Gene [Source:MGI Symbol;Acc:MGI:2683287]
interferon zeta Gene [Source:MGI Symbol;Acc:MGI:2448469]
interferon zeta-like [Source:RefSeq peptide;Acc:NP_001092311]
interferon zeta-like [Source:RefSeq peptide;Acc:NP_001092311]
interferon zeta-like [Source:RefSeq peptide;Acc:NP_001092311]
interferon zeta-like [Source:RefSeq peptide;Acc:NP_001092311]
interferon zeta-like [Source:RefSeq peptide;Acc:NP_001092311]
predicted gene 13271 Gene [Source:MGI Symbol;Acc:MGI:3701966]
predicted gene 13272 (Gm13272), mRNA [Source:RefSeq DNA;Acc:NM_001161608]
predicted gene 13275 Gene [Source:MGI Symbol;Acc:MGI:3701970]
predicted gene 13276 Gene [Source:MGI Symbol;Acc:MGI:3701972]
predicted gene 13283 Gene [Source:MGI Symbol;Acc:MGI:3649573]
predicted gene 13285 (Gm13285), mRNA [Source:RefSeq DNA;Acc:NM_001161609]
predicted gene 13288 Gene [Source:MGI Symbol;Acc:MGI:3701985]
predicted gene 13290 Gene [Source:MGI Symbol;Acc:MGI:3701990]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38383 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103993 Essential Splice Site 42 181 1 5
ENSDART00000129697 Essential Splice Site 43 170 2 6
Genomic Location (Zv9):
Chromosome 3 (position 22558769)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22215160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCAGAAAAACTTAATGAAGAGGACCTATACACTTCTGGAGACTGCG[G/C]TAAGATTTATTGCAGATAATCGTCAGTTTTATTATTGTATGTAACGAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link