im:6903726

Ensembl ID:
ENSDARG00000070673
ZFIN ID:
ZDB-GENE-050506-71
Description:
Im:6903726 protein [Source:UniProtKB/TrEMBL;Acc:Q6DEI9]
Human Orthologue:
PTGR2
Human Description:
prostaglandin reductase 2 [Source:HGNC Symbol;Acc:20149]
Mouse Orthologue:
Ptgr2
Mouse Description:
prostaglandin reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1916372]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12521 Nonsense Available for shipment Available now
sa12562 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103985 Nonsense 45 384 2 10
ENSDART00000103985 Nonsense 45 384 2 10
Genomic Location:
Chromosome 17 (position 37466776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGCGTTAATAAAAAAGAGAAAATGTTAAATGTAACAAGAGTTGTGT[T/A]RAGCTCCCGAYCAGGTAAATGTTAAAGGTTTTGWTCAGCTTACACWACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103985 Nonsense 45 384 2 10
ENSDART00000103985 Nonsense 45 384 2 10
Genomic Location:
Chromosome 17 (position 37466776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGCGTTAATAAAAAAGAGAAAATGTTAAATGTAACAAGAGTTGTGT[T/A]RAGCTCCCGAYCAGGTAAATGTTAAAGGTTTTGWTCAGCTTACACWACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ing1c2n6